TXT (투모로우바이투게더) 'Blue Hour' Official MV

  • Am Vor year

    HYBE LABELSHYBE LABELS

    TXT (투모로우바이투게더) '5시 53분의 하늘에서 발견한 너와 나' Official MV

    Director : Guzza (Lumpens)
    Assistant Director : Hyunhee Lim, Kookki Kim

    Director of Photography : Eumko
    Focus Puller : Sangwoo Yun, Jaewon Jung
    2nd : Youngwoo Lee
    DIT : Eunil Lee
    3rd : Yuntae Ko

    Gaffer : Junghyeok Jeong
    Lighting Crew : Junmin Yang ,Seungho Baek, Hyeonseok Kim, Duhyeon Han, Junseok Oh, Minseong Choi, Dowon Ahn, Gukjin Jeong

    Jimmy Jib Operator : Youngjung Kim
    Jimmy Jib Assistant : Hyunin Kim, Sung Hoon Kim

    Technocrane Operator : Taehyeon Choi

    Art Director : Jinsil Park, Bona Kim (MU:E)
    Assistant Art team : Yeri Kang (MU:E)
    Art-team Manager : ilho Heo (MU:E)

    Associate Producer : Emma Sungeun Kim (ge production)
    Location Manager : Jihoon Han
    Assistant Producer : Eunah- Seo

    VFX STUDIO : PLASTIC BEACH
    VFX Supervisor : Ohzeon
    VFX Assistant Supervisor : Jojeem
    VFX Project Manager : Chanyoung Song, Jieun Jeong
    VFX Producer : Kyutae Jang
    3D Artist : Kwangwon Lee, Doyeon Kim, Jeonghwa Lee, Jiwon Jeon
    2D Artist : Gihoon Jang, Hyunjun Lee

    Visual Creative : Nu Kim, Lee Hyun Ju, Kang Sung Do, Jung Su Jung, Cha Yeon Hwa, Rakta
    Artist Management : Kim Shin Gyu, Yang Jun Hyeong, Kim Ji Soo, Shin Seung Chan
    Performance Directing : Son Sung Deuk, Kim Su Bin, Kwon Yoo Jung, Hyewon Park

    Big Hit Entertainment. Rights are reserved selectively in the video.
    Unauthorized reproduction is a violation of applicable laws.
    Manufactured by Big Hit Entertainment, Seoul, Korea

    Connect with TOMORROW X TOGETHER:
    twitter.com/TXT_bighit
    facebook.com/TXT.bighit
    de-film.com/us/txt_bighit
    instagram.com/txt_bighit
    www.weibo.com/TXTbighit
    i.youku.com/txtbighit

Minyoni
Minyoni

Everything is so magical and so beautiful

Vor year
Televizyon Mal
Televizyon Mal

My drama queen

Vor 5 Monate
choke me nayeon
choke me nayeon

yess

Vor 8 Monate
fgh fgh
fgh fgh

I love you Yeonjun

Vor 8 Monate
sutaak
sutaak

Yeah

Vor 8 Monate
sutaak
sutaak

Ikr 😭💓

Vor 9 Monate
Sunil Sarkar
Sunil Sarkar

I think that TXT is the best male k-pop grup ❤️❤️❤️❤️❤️

Vor 15 Tage
Lamora Amora
Lamora Amora

No emoji

Vor 14 Stunden
Lamora Amora
Lamora Amora

............

Vor 14 Stunden
Sarah Rose
Sarah Rose

Y I'm late to stan this group? I started staning them since may 2022 ,i found this precious treasure too late :( But I'm glad I at least found them ♡´・ᴗ・`♡

Vor 23 Tage
Itzmin
Itzmin

@not a simp payasos como Stay 🤡

Vor 6 Stunden
Sarah Rose
Sarah Rose

@Justin_Seagull‘s_Banana_Milk We're both too late. But now I know everything about them. I am very happy to have this precious treasure. They are truly amazing and deserve great fame :)

Vor 9 Stunden
Justin_Seagull‘s_Banana_Milk
Justin_Seagull‘s_Banana_Milk

Same :) i staning them since june :,)

Vor 10 Stunden
Sarah Rose
Sarah Rose

@Narita julia ghamshabinda

Vor 15 Stunden
Narita julia
Narita julia

welcome moaa

Vor 18 Stunden
luck
luck

For new MOAS! Blue hair: Soobin 0:21 Pink hair: Yeonjun 1:54 Blonde hair: Taehyun 1:42 Brown hair: Hueningkai 3:57 Brown hair: Beomgyu 3:04

Vor Monat
michi
michi

I instantly fell in love with Beomgyu

Vor Tag
mariposa Libra
mariposa Libra

@Kiyoko Shimizu M: Moments O: Of A:Alwayness

Vor 5 Tage
Kiyoko Shimizu
Kiyoko Shimizu

Ty :) I have a question, why are the txt stand called MOAS😭

Vor 5 Tage
D Nura
D Nura

@Callax OMG same

Vor 7 Tage
Bts is my first love Straykids is my last love
Bts is my first love Straykids is my last love

Thank that's really helpful 😊

Vor 7 Tage
dearsputnik
dearsputnik

blue hour is my fav txt era fr such a masterpiece

Vor 8 Tage
thv_2~
thv_2~

Same

Vor 8 Tage
Sweetlyx TK
Sweetlyx TK

Don't worry you're not alone still listening this beautiful song

Vor year
Anlli Diaz #11
Anlli Diaz #11

@TXTLUVBOT♡ no

Vor 11 Stunden
♡𝚓𝚒𝚖𝚒𝚗𝚜𝚝𝚎𝚊♡︎
♡𝚓𝚒𝚖𝚒𝚗𝚜𝚝𝚎𝚊♡︎

💙💙

Vor Tag
Saroj gairola
Saroj gairola

Well nothing to worry about

Vor 2 Tage
No comment
No comment

True

Vor 3 Tage
buttercup⁷
buttercup⁷

Yepp

Vor 27 Tage
Shotaro is an Otter
Shotaro is an Otter

1:54 Everytime that yeonjun's part come, Beomgyu iconic mimic is playing in my head !!!

Vor 16 Tage
☽︎ sᴀɴᴅ ᴡɪᴛᴄʜ ☾︎
☽︎ sᴀɴᴅ ᴡɪᴛᴄʜ ☾︎

Samee omg 😂🤣

Vor 3 Tage
(っ◔◡◔)っ ♥ Chloe_BTS Army ♥
(っ◔◡◔)っ ♥ Chloe_BTS Army ♥

omg same

Vor 3 Tage
mariposa Libra
mariposa Libra

@sabina blue ramen I can relate All I hear is Beomgyu

Vor 5 Tage
A i y a h
A i y a h

SAMMEE

Vor 5 Tage
Sanskriti Pandey
Sanskriti Pandey

Same 🤣🤣❤️❤️❤️

Vor 8 Tage
soobun
soobun

i honestly can't begin to explain how much i love blue hour era. As a boy who likes to paint my nails and wear crop tops and have long hair but was too scared in the past, seeing 5 boys wear crop tops, have colourful hair, paint their nails whilst having fun and looking amazing really meant the world to me and made me more confident. it made me become a moa and stan txt! ily txt and i miss blue hour era sm, it's my favourite bg comeback of all time for sure!! it was so refreshing to see a more cute and colourful concept that i dont see so much in boy groups these days.

Vor 29 Tage
eN
eN

I'm so happy for you!! Feel proud and do what you want to do. Society is a messed up place so trying to fit in is the worst thing you can do to yourself. So free your beautiful soul. We all are there for you!!! 💙

Vor Tag
(っ◔◡◔)っ ♥ Chloe_BTS Army ♥
(っ◔◡◔)っ ♥ Chloe_BTS Army ♥

Thats amazing.Dont ever lose confidence again! Have a nice day :)

Vor 3 Tage
Mukbangchan💪🏾
Mukbangchan💪🏾

@Freedom smc ARE YOU BLIND👁

Vor 4 Tage
Mukbangchan💪🏾
Mukbangchan💪🏾

@Freedom smc IN THE VIDEO💀

Vor 4 Tage
Thursday's child
Thursday's child

I'm so happy txt were a huge help in gaining your confidence They're the best, they'd be so happy to hear this

Vor 5 Tage
Alexia
Alexia

Im a certified MOA this july! Im just watching their funny clips before, but now i really like them.. especially their personality. They r so humorous!!! Ig im a baby moa now haha💗😁

Vor 2 Tage
Lamora Amora
Lamora Amora

............. No emoji

Vor 14 Stunden
L A Y A N
L A Y A N

Best band in the fourth generation

Vor 7 Tage
mel
mel

so true

Vor 7 Tage
Grls Rule
Grls Rule

*TXT are the living definition of "aesthetic"* Stan TXT for clear skin

Vor year
Rumena Rahman
Rumena Rahman

I've already stan them & my bias is Soobin.😅😅😅

Vor 2 Monate
taniagoun
taniagoun

Yes

Vor 3 Monate
Md Hasan
Md Hasan

yes baby

Vor 3 Monate
ØItz_ellie_hereØ
ØItz_ellie_hereØ

Yes's I love that 💜💖😳

Vor 3 Monate
animon !!!
animon !!!

@Ali _07 clowns wearing crowns

Vor 3 Monate
Priscilla Castro
Priscilla Castro

Esse mv sempre vai ser um dos mais lindos q vi

Vor 5 Tage
Leony Utami
Leony Utami

450k to 158M moa!! keep going, we are doing so great!

Vor 9 Tage
Santos Acosta
Santos Acosta

que nostalgiaaaa, con esta canción los conocí ;(((

Vor 2 Tage
Jk oppa
Jk oppa

ImaJination 💯 Visuals 💯 Vocals 💯 Dance 💯 Stage presence 💯 It's just soo purrfect!!

Vor 2 Monate
Lamora Amora
Lamora Amora

...........

Vor 14 Stunden
𝐜𝐡𝐚𝐫𝐦𝐲.
𝐜𝐡𝐚𝐫𝐦𝐲.

....

Vor 4 Tage
BtSterryy
BtSterryy

@Nini ?

Vor 19 Tage
Nini
Nini

....

Vor 22 Tage
ʜʏᴜɴᴊɪɴ's ʜᴀɪʀʙᴀɴᴅ
ʜʏᴜɴᴊɪɴ's ʜᴀɪʀʙᴀɴᴅ

Yas our wwh jin

Vor 28 Tage
RJ
RJ

Fun fact: This song never gets old.

Vor year
Charlene 171
Charlene 171

YES

Vor 7 Monate
Umme Batul
Umme Batul

A FRISKING GREE

Vor 7 Monate
Ragini
Ragini

True

Vor 7 Monate
Sebastián paredes
Sebastián paredes

Nunca

Vor 9 Monate
Animelover 143
Animelover 143

guys pls keep on str34ming TXT Lovesong MV and all other songs it maybe recent or previous tracks in YT and spotify. We really need to increase our views for us to give TXT a year end music award. Let's reach more milestone with TXT together, i know we can do it as long as we have perseverance, consistentcy and determination to do so, fighting!!! --i'am doing this with my own free will not just to help out but to motivate y'all♡

Vor year
Nguyễn Hà
Nguyễn Hà

Moa, can we help this MV reach 200M vi3ws before its 2nd anniversary? Let's achieve this goal together!!

Vor 10 Tage
Loriecka
Loriecka

we can reach that if we'll stream this every day

Vor Tag
Crystal Jun
Crystal Jun

TXT are unique and indeed the 4th Gen Kings !

Vor 15 Tage
喔嗨喲
喔嗨喲

June 17, 2022,I fell in love with this group and regret why I didn't get to know txt when my friend recommended them to me a year ago

Vor 12 Stunden
Marie Aquila Lobaton
Marie Aquila Lobaton

This song is so addicting

Vor 19 Tage
Kimchi Slap
Kimchi Slap

Fact: This song never fails to cheer you up.

Vor year
Pumpspookymonthfernanda
Pumpspookymonthfernanda

Wow had to expose me 🙄🤚

Vor 2 Monate
Seokjins's Quail Eggs
Seokjins's Quail Eggs

This is so true

Vor 5 Monate
Bangchan_Sonyeondan
Bangchan_Sonyeondan

@수 Ohhh that one about the two best friends?

Vor 5 Monate
수

@Bangchan_Sonyeondan " under the sky in room 553 i discovered you and i "

Vor 5 Monate
Bangchan_Sonyeondan
Bangchan_Sonyeondan

@수 .... what fanfic ..?

Vor 5 Monate
camila martinez
camila martinez

los amoooo mucho 🥰🥰

Vor 5 Tage
BTS TXT TRASHEU
BTS TXT TRASHEU

Because of this song i became an MOA 💙

Vor 15 Tage
rzsurface
rzsurface

ほんとに名曲 何度聴いても飽きない

Vor 22 Tage
BTS WORLD
BTS WORLD

Yes

Vor 2 Tage
はな
はな

それなすぎる

Vor 10 Tage
fandomic
fandomic

I wake up in the morning with this beautiful song nowadays.

Vor 2 Tage
Blessie Barredo
Blessie Barredo

I'm glad I'm not the only one who keep watching and listening to this masterpiece

Vor year
bbhyt
bbhyt

اي بلكعبه حته اني

Vor 8 Monate
Bangchan_Sonyeondan
Bangchan_Sonyeondan

Yesss

Vor 8 Monate
صديقة سيشومارو Sy
صديقة سيشومارو Sy

stream moa 200m

Vor 8 Monate
هوبي شوشو
هوبي شوشو

stream moa 200m

Vor 8 Monate
Angel Roy
Angel Roy

Yes you're not alone 😁

Vor 8 Monate
Kokobop
Kokobop

This masterpiece never gets old ♡

Vor Monat
Helen Raju
Helen Raju

No one can beat TXT in concept TXT CONCEPT KINGS!!!!

Vor 8 Tage
Margel Contreras
Margel Contreras

Ahora solo puedo escuchar el rap de Beomgyu jajajaja

Vor 25 Tage
STAN Tomorrow by Todoro
STAN Tomorrow by Todoro

No one knows how much i'm addicted to this song

Vor 3 Tage
Hoe
Hoe

I can't unhear Yeonjun's part without Beomgyu trying to imitate his voice. 😭

Vor 8 Monate
Summer :D
Summer :D

Sameeee😭😂

Vor 3 Monate
방탄보바bangtannboba
방탄보바bangtannboba

SAMEEEEE LMAOOOO

Vor 3 Monate
Ankita Mondal
Ankita Mondal

🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣

Vor 4 Monate
Hannie Oooh
Hannie Oooh

Literally was waiting for someone to comment about this 😂😭

Vor 4 Monate
hoe 4 jk
hoe 4 jk

omg same lmaooo Beomgyu's voice is coming thru my head whenever Yeonjun's part play 😭😭

Vor 5 Monate
Maria Magdalene Ducay
Maria Magdalene Ducay

we're so close to 160M! do not forget to take care of yourself during, before, and after str3@ming :)

Vor 2 Tage
Guiltyboi
Guiltyboi

Just got introduced towards this group's songs and I have to say, these are amazing for sure

Vor Monat
Appreciate what you have🌹And be patient💐
Appreciate what you have🌹And be patient💐

Welcome to the chill clown club in advanced bestie

Vor 29 Tage
Leony Utami
Leony Utami

happy 157M moa. you are doing great.

Vor 16 Tage
strawberry
strawberry

I will NEVER get over Yeonjun in a crop top :')

Vor 2 Tage
J
J

Imagine how nostalgic this will sound after 10 years ☹️

Vor 6 Monate
sCarz X
sCarz X

Omg stop ur making me cry 😭

Vor 4 Monate
127 dream
127 dream

😭

Vor 4 Monate
sCarz X
sCarz X

😭 😭 😭

Vor 4 Monate
Jacob Guerra
Jacob Guerra

I love you guys TXT you’re the best and I love blue hour that’s my favorite song

Vor 15 Tage
Papeleria La economica
Papeleria La economica

BEOMGYU TE AMO POR EL RESTO DE MI VIDA

Vor 5 Tage
i’m coming for your ass
i’m coming for your ass

40 years later and you will still see me dance to blue hour's dance break in a random park

Vor 2 Tage
민윤기의 원래 아내 💜
민윤기의 원래 아내 💜

أغنية رائعة لن أتوقف عن سماعها ❤️🇲🇦

Vor 18 Tage
Xmix Nb
Xmix Nb

انا ايضا

Vor 14 Tage
Namu
Namu

MOAS, LISTAS PARA QUE ESTA JOYITA LLEGUE A LOS 100M? ¡SIGAMOS CON EL STR3M34N, NO PAREMOS TODO ES POR Y PARA LOS CHICOS!♡

Vor year
Namu
Namu

@Sofia Lisset, Si hay que apurarnos para que antes de su comeback tengan los 100M, NO hay que relajarnos, SIGAMOS CON EL STR3M34N♡

Vor year
Sofia Lisset
Sofia Lisset

Quiero q lleguen 3 días a los 100 millones ese día se cumple 7 meses de la canción ¿lograremos eso? Claro si todos ponemos de nuestra parte vamos moa sigamos con el str3m34m

Vor year
Namu
Namu

@daniela peñafiel, SII, SIGAMOSSSSS NO PAREMOS♡

Vor year
Namu
Namu

@Nani_TxT.EN-.CNCO.BTS.Kep1er_ sigamos, Pronto lo lograremos y justo para su comeback♡

Vor year
daniela peñafiel
daniela peñafiel

Si ya falta poco

Vor year
Harvey Dodoso
Harvey Dodoso

TXT never disappoint us, they are my special✌️

Vor Tag
army com orgulho💜
army com orgulho💜

ilove you txt amor da minha vida😍😍😍😍😍😍😘

Vor 27 Tage
Mylittle deer
Mylittle deer

No matter how long time pass, this song will always stay in my mind

Vor 2 Monate
souRare
souRare

Here I am listening them daily. I am addicted !!!

Vor 2 Monate
Zeeek C
Zeeek C

Im here to support the TXT babies. I swear they've never had a bad comeback. This song is amazing and so catchy. They also have the most unique concepts in kpop. None of their music videos look like anything else that is out there. Good job, Txt! cheering for you

Vor year
Anna Lou Fabbri
Anna Lou Fabbri

@Shi💜 BTS & ARMY💜 sleep well sweetie

Vor 9 Tage
Anna Lou Fabbri
Anna Lou Fabbri

@Shi💜 BTS & ARMY💜 yes dear

Vor 9 Tage
Anna Lou Fabbri
Anna Lou Fabbri

@Shi💜 BTS & ARMY💜 do you remember my name?

Vor 9 Tage
Anna Lou Fabbri
Anna Lou Fabbri

@Shi💜 BTS & ARMY💜 we are friends now

Vor 9 Tage
Anna Lou Fabbri
Anna Lou Fabbri

@Shi💜 BTS & ARMY💜 well

Vor 9 Tage
rollergrrl
rollergrrl

I still love this song. This mini-album is a classic.

Vor 4 Tage
Jessica Lary
Jessica Lary

Só Deus sabe sabe o quanto gritei e reassisti a parte da break 💜

Vor 24 Tage
April Joyce Vicente
April Joyce Vicente

I really love this!!! Especially the dance!!!

Vor Monat
Jєσи Jĸ ♡♕
Jєσи Jĸ ♡♕

This is the first song I've heard from TXT and it will always be my favorite because it made me get to know this amazing group

Vor 2 Tage
Aaema Shaikh
Aaema Shaikh

Fact : The worst part of this song is that it ends.

Vor year
hypentxteez💕
hypentxteez💕

Faaaaaaaaaacccccccccttttttt (screaming loudly)

Vor 11 Monate
Donutplayzzz
Donutplayzzz

Exactly 🥲

Vor 11 Monate
Animelover 143
Animelover 143

guys pls keep on str34ming TXT Lovesong MV and all other songs it maybe recent or previous tracks in YT and spotify. We really need to increase our views for us to give TXT a year end music award. Let's reach more milestone with TXT together, i know we can do it as long as we have perseverance, consistentcy and determination to do so, fighting!!! --i'am doing this with my own free will not just to help out but to motivate y'all♡..

Vor year
to god be the glory
to god be the glory

🚨Guys we need help: Keep on voting rn for TXT on IDOLCHAMP cause it will end today at exactly 11:59pm kst and STARPASS APP will end tomorrow at exactly 2pm kst moa the second place are catching up fast, lets take the lead once again fighting!!! ---Pls lets win this for TXT

Vor year
i’m coming for your ass
i’m coming for your ass

i can be 80 years old some years into the future,but i'll still be vibin' to this song.

Vor 12 Tage
gyunie
gyunie

Me hice moa con ésta canción y no me arrepiento de nada

Vor 2 Monate
Alejandra Alvarez del Castillo
Alejandra Alvarez del Castillo

I remember how excited I was when they announced Blue Hour’s album because it was my first comeback as a MOA, isn’t it funny how fast the time flies?

Vor 22 Tage
Alka
Alka

Moa let's make it 200m within this year we have to 44m more fighting str3@m it daily

Vor 26 Tage
해윤
해윤

i’m not a MOA but TXT really deserves to win, this is a really good song :(

Vor year
to god be the glory
to god be the glory

keep on str34ming Blue hour moas and pls vote for TXT in Mubeat (best dance perf.) categpry and in whosfan (best in the universe) fighting =)

Vor year
Kimi No Na Wa
Kimi No Na Wa

keep on str34ming and vote for TXT in Mubeat app on best dance perf. category, fighting=)

Vor year
noura taha
noura taha

ilyyyy tysm for your support

Vor year
txtluv
txtluv

MOAs PLEASE GO VOTE FOR TXT IN MUBEAT “BEST BOY GROUP PERFORMANCE”!!!

Vor year
yannah khylee ^ ^
yannah khylee ^ ^

yeah :(

Vor year
Ana María Lopez Siles
Ana María Lopez Siles

Hagamos q Txt tenga Un Mv de 200 M

Vor Monat
Soni Singh
Soni Singh

I remember when this song came so many new fans joined us. I used to tell them about the members name, recommend them their songs. So many people praised my bias Beomgyu in this era. I made many moa friends. The nostalgia is hitting me.

Vor Monat
Karen Mariela Valdez
Karen Mariela Valdez

Sigo sin superar que el dance break no esté en Spotify. IM CRYING ༎ຶ‿༎ຶ

Vor Monat
junie 974
junie 974

I love Blue Hour so much

Vor 2 Monate
Tae min
Tae min

Fun fact: every single scene of this mv can be a wallpaper

Vor year
can't you see me ? 🇺🇦
can't you see me ? 🇺🇦

@ENHYPEN is the best thank you >

Vor 6 Monate
ENHYPEN is the best
ENHYPEN is the best

@can't you see me ? 🇺🇦 ok

Vor 6 Monate
ENHYPEN is the best
ENHYPEN is the best

Your rite

Vor 8 Monate
s v
s v

True 🤍💜

Vor 8 Monate
JISOOBLP4 Kurdishblink5
JISOOBLP4 Kurdishblink5

This song it's perfect THE Vocal is Perfect The Dance The lyrics The melody The Outfits The Blu hair Soobin and Pink hair Yeonjun and all the members are so Handsome

Vor 10 Tage
Sri
Sri

It’s so beautiful and magical.

Vor Monat
rvi♌
rvi♌

They always leave me shocked with how unique, new different they are. Everytime i come back here i just get even more amazed. TOMORROW X TOGETHER, You guys are a true legend.

Vor 2 Monate
][̲̅ KIM G£ΣA ㉨][̲̅ #fuerzaarmyeucrania
][̲̅ KIM G£ΣA ㉨][̲̅ #fuerzaarmyeucrania

Que canción tan lindaaaaaaaaaa me derrito, es tan lindaaaa ^_^

Vor Monat
hobi's sprite 🥤
hobi's sprite 🥤

Not a moa but this is so iconic and addictive Update: I'm a moa now

Vor year
Nur Qistina
Nur Qistina

YEAY UR A MOAAA

Vor 11 Monate
tbt
tbt

yes we love the character development 🤩 jk welcome moa!

Vor 11 Monate
🤍I believe In Huening Bahiyyih supremacy🖤
🤍I believe In Huening Bahiyyih supremacy🖤

@Dr Rupnath Pegu the person can be a multi stan u know... Idk if ur new to the Fandom or not but Pls be nice and peaceful to new moas Let's not lose our label as one of the most peaceful Fandoms in kpop..

Vor 11 Monate
:v
:v

@𝗱𝗲𝗱𝗱𝘆𝘆𝘆𝘆𝘆𝘆𝘆𝘆 you can stan multiple group if you like bts, txt and bp then stan all of them don't let others decided for which group you want wanna stan, it's all up to youu (if you wanna know deeper about the stan thing: stan as a word had mixed opinion of the definition of that word, the word used to be very problematic but nowadays the meaning now has change to a more very softer tone overtime mostly because of kpop fans till now people still fought over the meaning of it, i personally have tried my best to stay away from the word stan but it sort have became an habit i couldn't help it, sorry it this doesn't make sense i'm bad at explaning things)

Vor 11 Monate
Srijeeta Roy
Srijeeta Roy

as it should be

Vor 11 Monate
Huekiss
Huekiss

Can't wait for your comeback, guys. As a new fan, I'm really looking forward to it because this will be my first comeback with you ☺️❤️

Vor 2 Monate
Anna Lou Fabbri
Anna Lou Fabbri

😭😭😭😭😭😭😭😭😭😭❤❤❤❤

Vor 15 Tage
Nini
Nini

....

Vor 22 Tage
Appreciate what you have🌹And be patient💐
Appreciate what you have🌹And be patient💐

WELCOME NEW CHILL CLOWN MOA BETSIE :D remember to stay chill and ignore the haters , never bring other artists down and just have a blast with TXT and MOA

Vor 29 Tage
Moshiul Alam Mashuk
Moshiul Alam Mashuk

@Sangay Bidha Dorji i came to the fandom in lovesong era, it is already a year

Vor 2 Monate
Andrea Rivera
Andrea Rivera

Sameeeee

Vor 2 Monate
Hech Jay
Hech Jay

Always love this

Vor 2 Monate
shoogi
shoogi

words cannot EXPLAIN how much i love this song and era

Vor 27 Tage
Eryx
Eryx

T-the spotify version seems to be missing something? T-T no problem I'll just stream it on repeat here

Vor Tag
Anika Annigeri
Anika Annigeri

I can't believe this fandom has grown so big...

Vor year
Almeniana
Almeniana

20k more before 94M. Let's goooo

Vor year
Almeniana
Almeniana

S T R E A M

Vor year
gamer ff
gamer ff

Not elevator but stairs

Vor year
luzmania
luzmania

Proud MOA!

Vor year
sheepgarden_won
sheepgarden_won

I love their voice they're so talented

Vor Monat
Hmmm Hmmm
Hmmm Hmmm

This song is so nostalgic even though it was just released half a year before. It just gives me memories of quarantine times.

Vor Monat
KPOP HITS
KPOP HITS

I am here because I'm obsessed with this song

Vor 2 Monate
KPOP LOVER RADIA♥
KPOP LOVER RADIA♥

150 millions doneeeee!!!!we did it MOA's!!!!!

Vor 2 Monate
A.
A.

TXT is not trying to be talented, Talented is trying to be TXT

Vor year
Animelover 143
Animelover 143

guys pls keep on str34ming TXT Lovesong MV and all other songs it maybe recent or previous tracks in YT and spotify. We really need to increase our views for us to give TXT a year end music award. Let's reach more milestone with TXT together, i know we can do it as long as we have perseverance, consistentcy and determination to do so, fighting!!! --i'am doing this with my own free will not just to help out but to motivate y'all♡

Vor year
Pavini Lal
Pavini Lal

Periodt💅💅

Vor year
Wolftoris
Wolftoris

LOUDERRR!!

Vor year
SHAHZAIB SOHAIL
SHAHZAIB SOHAIL

Woah

Vor year
Escarch Lover
Escarch Lover

Buenos días/ noches Moa, pasala muy bien.. Escuchar de Blue Hour a cualquier momento es genial , sentir la única magia de la çanción y de TXT sentirte muy feliz al estar con ellos.

Vor 6 Tage
Christian Orence
Christian Orence

not yet late to stan this group 😍 their vocals are perfect! the 5 of them are total package

Vor 12 Tage
VANESSA CHAVEZ BUELOT
VANESSA CHAVEZ BUELOT

Recuerdo que desde la primera vez que escuché BH me obsesione con la letra, el ritmo y caí por 5 chicos talentosos

Vor 25 Tage
Priyanka Bhandari
Priyanka Bhandari

I love it💕💕💕😌😌😌🎶🎧🎧🎧

Vor Monat
Margaret Farra
Margaret Farra

Concept: 100% Hair: 100% Outfits: 100% Choreography: 100% Vocals: 100% TOTAL SCORE: 1000% Edit: thanks for all the likes and keep streaming :)))

Vor year
Javaria Urooj
Javaria Urooj

@Margaret Farra YASS

Vor Monat
Javaria Urooj
Javaria Urooj

And a bit of imperfections : 000000.0000%

Vor Monat
aa tv
aa tv

ITS 500

Vor Monat
Animelover 143
Animelover 143

guys pls keep on str34ming TXT Lovesong MV and all other songs it maybe recent or previous tracks in YT and spotify. We really need to increase our views for us to give TXT a year end music award. Let's reach more milestone with TXT together, i know we can do it as long as we have perseverance, consistentcy and determination to do so, fighting!!! --i'am doing this with my own free will not just to help out but to motivate y'all♡..

Vor year
Bts army 💜💜FoR EvEr
Bts army 💜💜FoR EvEr

The song is magical and pretty as them...

Vor Monat
Bts world universe 77
Bts world universe 77

3:18 i really like this part

Vor 6 Tage
SOUR
SOUR

i love this song so much

Vor 2 Monate
jsjssjsjhsjs
jsjssjsjhsjs

EVERYTHING abt this m/v is gold ... the intro, the dance break ...

Vor Monat
clowns who? I only know MOAS🤡
clowns who? I only know MOAS🤡

It's only been 2 yrs since they debuted and they've given us many different genres and showed many sides and concepts of them Nobody is doing it like txt

Vor 10 Monate
Helen Raju
Helen Raju

@Ava Aco girl that's her opinion and how dare you say that in a TXT vid and I agree w this comment 😏

Vor 4 Tage
riya
riya

they are vv unique and im proud that i stanned them since mostly im associated with girl groups! never regretted it tbh

Vor Monat
Jill
Jill

we stan a group who really deserve the title "4th gen leaders"

Vor 9 Monate
Ayumira Diana
Ayumira Diana

yes

Vor 9 Monate
최소영
최소영

@Ava Aco oh wow that time i was just 5 yr old that i just used to watch cartoons on phone 😂

Vor 9 Monate
James Lion
James Lion

I am absolut not a fan of k pop absolutley not but this one is diffrent man i dont know it is a pure happy maker. Everytime when i hear this something in my mind or body is Rhythmus and imagine it makes pure happy :-) hahaha. But only this one.

Vor 2 Monate
Victoria
Victoria

u should give it a try :)

Vor Monat
Jenny Park
Jenny Park

I saw a clip of the MV on tiktok & I’m so glad I came back to watch it - the visuals & vibes are so dreamy and beautiful!

Vor 23 Tage
Adshenture
Adshenture

Happy 150M!! It hit while I was asleep, but I'm so proud of MOA and our efforts to stream. We got it in 533 days, a little under half the time it took us to get Crown to the same milestone. Not elevator, but stairs! We're doing it MOA!!

Vor 2 Monate
Bang x together
Bang x together

Whatever happens Blue hour lives rent free inside my heart thank you for such an amazing song TXT

Vor 4 Tage
Quincy Luis
Quincy Luis

MOAs don't forget to share this to non fans, let's push it to 4M likes

Vor year
Sand Hanitizer
Sand Hanitizer

I'm on it 🏃🏃

Vor year
Javaria Urooj
Javaria Urooj

This song is peaceful but it has energy too! This is magical

Vor Monat
dear angge
dear angge

why is this version not on Spotify?? 😩

Vor 2 Monate
Nini
Nini

...

Vor 22 Tage
txt rock🤙
txt rock🤙

Idk

Vor 2 Monate
soobie
soobie

to think that this masterpiece will be a 2 year old song soon, time flies so fast

Vor 25 Tage
Rishika Gupta
Rishika Gupta

MOAs we should make this MV reach 200M before it touches its second anniversary. Keep streaming along with other MVs especially GBGB.

Vor 26 Tage
웃다
웃다

yes

Vor 26 Tage
forever with nu'est
forever with nu'est

We're almost there, we're going to achieve our goals. Don't forget to prepare for the cb

Vor year
Animelover 143
Animelover 143

guys pls keep on str34ming TXT Lovesong MV and all other songs it maybe recent or previous tracks in YT and spotify. We really need to increase our views for us to give TXT a year end music award. Let's reach more milestone with TXT together, i know we can do it as long as we have perseverance, consistentcy and determination to do so, fighting!!! --i'am doing this with my own free will not just to help out but to motivate y'all♡..

Vor year
Born at a very young age
Born at a very young age

...

Vor year
Uzma Hameed
Uzma Hameed

done sis

Vor year
Nature lover 🌿🌱
Nature lover 🌿🌱

And how many views we want this MV to reach?

Vor year
Ambra
Ambra

Their arm choreo's are outstanding!

Vor 11 Tage
soobindo
soobindo

this song is a pure masterpiece.

Vor 8 Tage
Leif Tribal
Leif Tribal

I'm so sad I only started listening to them about a week ago, I absolutely adore them now and I'm so excited to watch the livestream of their concert next week 😊 This song and video cheer me up so much, I'm so happy to be a MOA now ♡

Vor 10 Tage
방탄소년단 🐱
방탄소년단 🐱

Their 2nd mv hits 150M, congratulations!

Vor 2 Monate

Nächster

LO$ER=LO♡ER

3:18

LO$ER=LO♡ER

TOMORROW X TOGETHER OFFICIAL

Aufrufe 18 000 000

PSY - 'That That (prod. & feat. SUGA of BTS)' MV

3:37

Pied Piper

4:06

Pied Piper

BANGTANTV

Aufrufe 80 000 000

Post Breakup Haircut...  *Almost 30 Episode 1

8:16

BTS (防弾少年団) 'Airplane pt.2 -Japanese ver.-' Official MV

3:48

SOPHIA - Schmetterling (Official Video)

2:33

Murda & Hadise - Imdat (prod. Spanker)

4:47

Pajel - Blockstar [official video]

2:44

Estefania - Sommerliebe

2:52

Estefania - Sommerliebe

Estefania

Aufrufe 131 046

HOODBLAQ - BARRIO (prod. Shokii)

3:49

HOODBLAQ - BARRIO (prod. Shokii)

HOODBLAQ

Aufrufe 1 022 019